Sendu inn spurningu

Hér getur þú sent okkur nýjar spurningar um vísindaleg efni.

Hafðu spurninguna stutta og hnitmiðaða og sendu aðeins eina í einu. Einlægar og vandaðar spurningar um mikilvæg efni eru líklegastar til að kalla fram vönduð og greið svör. Ekki er víst að tími vinnist til að svara öllum spurningum.

Persónulegar upplýsingar um spyrjendur eru eingöngu notaðar í starfsemi vefsins, til dæmis til að svör verði við hæfi spyrjenda. Spurningum er ekki sinnt ef spyrjandi villir á sér heimildir eða segir ekki nægileg deili á sér.

Spurningum sem eru ekki á verksviði vefsins er eytt.

Að öðru leyti er hægt að spyrja Vísindavefinn um allt milli himins og jarðar!

=

Hvað felst í því að skrá erfðamengi mannsins og hvað hefur það í för með sér?

Þessari spurningu um skráningu erfðamengis mannsins var svarað af Guðmundi Eggertssyni á fyrsta starfsári Vísindavefsins, árið 2000. Síðan þá hefur ýmislegt gerst á sviði erfðavísindanna og því full ástæða til að svara spurningunni á nýjan leik. Eldra svarið stendur þó enn fyrir sínu, sjá: Hvað felst í því að skrá erfðamengi mannsins og hvað hefur það í för með sér?


Erfðaefnið í öllum lífverum á jörðinni er DNA-kjarnsýra. DNA er gormlaga og ber í sér upplýsingar um byggingu og starfsemi lífvera, hin svokölluðu gen. Kjarnsýran er tveir þræðir sem tvinnast saman og parast með ákveðnum einingum sem kallast kirni eða basar. Kirnin parast samkvæmt efnafræðilegum eiginleikum þannig að A parast við T, og C parast við G. Árið 1970 var kunngjörð aðferð sem gerði kleift að greina röð basa í bútum erfðaefnis. Margar lífefnafræðilegar aðferðir voru prófaðar í upphafi og enn eru nýjar aðferðir í þróun. Saman eru þessar aðferðir kallaðar DNA-raðgreiningar, og þær nýtast til að lesa röð basanna sem mynda genin og aðra hluti erfðamengisins. Fyrsta raðgreiningin á heilu erfðamengi var á veirunni MS2 árið 1976 og fyrsta bakterían, Haemophilus influenzae, var raðgreind 1995.

Röð basa í DNA má greina með efnahvarfi þar sem hver basi er litaður með sérstökum flúorljómandi hópi. Mismunur á staðsetningu og styrk ljóss á fjórum bylgjulengdum segir til um röð basa í ákveðnum DNA-bút eða geni.

Samfara tækniframförum kom upp sú hugmynd að skrá eða raðgreina erfðamengi mannsins. Það var mikil áskorun því erfðamengi Homo sapiens er mörgum sinnum stærra en erfðamengi veira og bakería. MS2-veiran hefur um 3.000 kirnapör en eitt sett af litningum okkar (23 alls) samanstendur af um það bil 3.200.000.000 kirnapörum. Ef litningar mannsins væru skrifaðir út í sömu leturstærð og nöfn í símaskrá, þyrfti um 200 símaskrár til að rita út eitt erfðamengi (miðað við 1000 bls. skrár). Raðgreining erfðamengis mannsins var risavaxið verkefni, sem þarfnaðist mikils skipulags og fjármagns. Bandarísk yfirvöld, með liðsinni Kanadamanna og Breta hönnuðu þrepaskipt verkefni sem átti að taka rúm 10 ár. Einkaaðilar, undir forystu Craig Venter, völdu aðra nálgun og fóru í kapp við hið opinbera. Markmið Venter var að sækja um einkaleyfi á genum. Sú hugmynd var felld því náttúrulegar erfðaupplýsingar lífvera eru ekki uppfinning. Engu að síður varð mikið kapphlaup um að ljúka raðgreiningu erfðamengisins.

Kapphlaupinu lauk með jafntefli og sumarið 2000 var fyrsta útgáfa af erfðamengi mannsins kynnt á blaðamannafundi á túni þáverandi Bandaríkjaforseta, Bills Clintons. Vísindagreinar um erfðamengið birtust síðan í febrúar 2001. Með því að skrá erfðamengi mannsins var röð basanna í genum og á litningum ákvörðuð. Einnig var hægt að skilja röð gena, byggingu og staðsetningu þeirra á litningum. Til dæmis byrjar genið Evx á atggagagccgaaaggacatggttatgtttctgga, og það liggur við hliðina á RNA-geninu HOTTIP. Raðgreiningin afhjúpaði líka aðra hluti erfðamengja og litninga, eins og þráðhöft, stökkla, stjórnsvæði og endurtekningar. En tæknin og raðgreiningar eru ófullkomnar. Sum svæði í erfðamengi dýra og plantna hafa það margar endurtekningar og stökkla að ekki hefur tekist að raðgreina þau. Erfðamengi okkar er þekkt að stærstu leyti en nokkur hundruð slík göt eru enn ófyllt.

En maðurinn á ekki bara eitt erfðamengi. Við eigum hvert tvö eintök af okkar eigin erfðamengi (eitt frá pabba og eitt frá mömmu) og þau eru ekki eins. Því á mannkynið rúmlega 14 milljarða erfðamengja (tvö í hverjum einstaklingi). Ástæðan er sú að í erfðaefninu eru frávik, breytingar á stökum kirnum eða jafnvel heilum genum eða litningahlutum. Þessi frávik kallast stökkbreytingar og þau má til dæmis finna með því að bera saman erfðamengi. Í ljós kemur að að minnsta kosti 15.000.000 staðir í erfðamengi mannsins eru breytilegir. Þar af leiðir að allir eru erfðafræðilega einstakir.

Breytileiki á milli einstaklinga var ein af kveikjunum að raðgreiningu erfðamengis mannsins. Hugmyndin var að auðveldara væri að kortleggja gen sem tengjast sjúkdómum, ef við vissum byggingu erfðamengisins. Kortlagning gena byggist á að kanna hvaða stökkbreytingar sýna fylgni við sjúkdóm eða einkenni, til dæmis þegar bornir eru saman 1000 astmasjúklingar og 1000 heilbrigðir (sjá mynd).

Til að greina áhrif stökkbreytinga er tíðni þeirra borin saman hjá hópi sjúklinga með ákveðinn sjúkdóm og sambærilegum viðmiðunarhóp. Í þessu tilbúna dæmi eru áhrif tveggja stökkbreytinga athuguð. Engin munur er á tíðni stökkbreytingar á basa 1 í lösnum og hraustum einstaklingum, en breyting á basa 2 er greinilega algengari lösnum en heilbrigðum.

Þegar búið er að staðfesta að stökkbreyting tengist sjúkdómi þá opnast möguleiki á dýpri skilningi á sjúkdómnum og um leið meðferð eða lækningu. En í mörgum tilfellum er björninn ekki unninn þegar stökkbreyting finnst. Guðmundur Eggertsson sagði árið 2000:
Þess er ekki að vænta að raðgreining genamengisins valdi byltingu í mannerfðafræðirannsóknum. Frekar má líta á hana sem fyrsta áfangann til fulls skilnings á erfðaefni mannsins og starfsemi þess. Næsti áfangi verður skilgreining á gerð og hlutverki allra þeirra prótína sem ákvörðuð eru af erfðaefninu.

Orð Guðmundar eiga enn við. Jafnvel þótt að við finnum erfðaþátt sem tengist sjúkdómi, þá er mikil vinna fyrir höndum að skilja hvernig hann hefur áhrif á sjúkdóminn. Þetta vandamál er því flóknara þar sem flestar stökkbreytingar eru meinlausar. Þær hafa engin áhrif á svipfarið, útlit eða eiginleika fólks.

Á þeim rúmleg 13 árum sem liðin eru frá raðgreiningu erfðamengis mannsins hafa tugþúsundir erfðamengja verið raðgreind. Flest mengin eru úr bakteríum, en einnig hafa erfðamengi tilraunalífvera eins og ávaxtaflugna, gersveppa og vorskriðnablóms verið skráð. Einnig hafa erfðamengi rúmlega 10.000 manns verið raðgreind og afhjúpuð. Gögn um tilraunalífverur eru aðgengileg í opnum gagnagrunnum, en vegna persónuverndar eru næstum öll erfðamengi manna í lokaðri gagnavörslu. Erfðamengjaöldin færði okkur erfðamengi mannsins, innsýn í sjúkdóma og líffræði okkar en einnig gríðarlega þekkingu á fjölbreytileika dýra, plantna og örvera.

Samantekt:
  • DNA raðgreining er aðferð til að greina röð basa í DNA.
  • Raðgreining erfðamengja afhjúpar röð gena, byggingu þeirra og þróunarlegan skyldleika.
  • Raðgreining erfðamengis mannsins auðveldar leitina að erfðaþáttum sem tengjast sjúkdómum.

Ítarefni:

Myndir:

Útgáfudagur

18.8.2014

Spyrjandi

Ritstjórn

Höfundur

Arnar Pálsson

erfðafræðingur

Tilvísun

Arnar Pálsson. „Hvað felst í því að skrá erfðamengi mannsins og hvað hefur það í för með sér?“ Vísindavefurinn, 18. ágúst 2014. Sótt 14. desember 2017. http://visindavefur.is/svar.php?id=67876.

Arnar Pálsson. (2014, 18. ágúst). Hvað felst í því að skrá erfðamengi mannsins og hvað hefur það í för með sér? Vísindavefurinn. Sótt af http://visindavefur.is/svar.php?id=67876

Arnar Pálsson. „Hvað felst í því að skrá erfðamengi mannsins og hvað hefur það í för með sér?“ Vísindavefurinn. 18. ágú. 2014. Vefsíða. 14. des. 2017. <http://visindavefur.is/svar.php?id=67876>.

Chicago | APA | MLA

Sendu inn spurningu
eða

Vísindadagatalið

Tvínafnakerfi

Svíinn Carl von Linné lagði grunninn að tvínafnakerfi líffræðinnar og flokkunaraðferðum sem þar er beitt. Tvínafnakerfið er notað til flokkunar á öllum lífverum, fyrra heitið stendur fyrir ættkvíslina en það síðara táknar tegundarheitið. Áður en Linné kom til sögunnar var fræðilegt heiti hunangsflugunnar alls 12 orð en með tvínafnakerfinu varð það einfaldlega Apis mellifera.